During an epidemiological survey carried out in the Botanical Garden at Bologna University, Cucumber mosaic virus (CMV) has been detected by applying PAS-ELISA technique infecting some ornamental species exhibiting a severe symptomatology on the leaves. Datura innoxia Miller. showed mosaic and leaf-curling; Globularia nudicaulis L. produced narrowed leaves with a yellow mosaic and/or variegation; Eupatorium cannabinum L. showed a systemic chlorotic and/or yellow mosaic and stunting. Reverse transcription-polymerase chain reaction (RT-PCR) and single strand conformation polymorphism (SSCP) were employed to characterise these CMV isolates. Total RNA was extracted from symptomatic leaf samples with a Qiagen RNeasy Plant Minikit (Qiagen S.P.A., Milan, Italy) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP+ CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt). All samples from the three ornamental species, yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with CMV isolates from other ornamental species present in the same Botanical Garden (Thevetia nereifolia and Nandina domestica). The results showed a different sequence variant for each CMV isolate, indicating that these tree isolates are a new accession in the Botanical Garden. Probably these isolates came from the original Country of the plants.
S.Davino, M.Davino, M.G.Bellardi (2006). Molecular characterization of Cucumber Mosaic Virus isolates infecting ornamental species cultivated in the Botanical Garden of Bologna University.
Molecular characterization of Cucumber Mosaic Virus isolates infecting ornamental species cultivated in the Botanical Garden of Bologna University
BELLARDI, MARIA GRAZIA
2006
Abstract
During an epidemiological survey carried out in the Botanical Garden at Bologna University, Cucumber mosaic virus (CMV) has been detected by applying PAS-ELISA technique infecting some ornamental species exhibiting a severe symptomatology on the leaves. Datura innoxia Miller. showed mosaic and leaf-curling; Globularia nudicaulis L. produced narrowed leaves with a yellow mosaic and/or variegation; Eupatorium cannabinum L. showed a systemic chlorotic and/or yellow mosaic and stunting. Reverse transcription-polymerase chain reaction (RT-PCR) and single strand conformation polymorphism (SSCP) were employed to characterise these CMV isolates. Total RNA was extracted from symptomatic leaf samples with a Qiagen RNeasy Plant Minikit (Qiagen S.P.A., Milan, Italy) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP+ CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt). All samples from the three ornamental species, yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with CMV isolates from other ornamental species present in the same Botanical Garden (Thevetia nereifolia and Nandina domestica). The results showed a different sequence variant for each CMV isolate, indicating that these tree isolates are a new accession in the Botanical Garden. Probably these isolates came from the original Country of the plants.I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.



